View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18759_low_9 (Length: 361)
Name: NF18759_low_9
Description: NF18759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18759_low_9 |
 |  |
|
| [»] scaffold0130 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 36283919 - 36284108
Alignment:
| Q |
18 |
cattcatacctgaattattgtgcaggctgattgcgataataacattcaatgaaattagtacttttagtaagcaatttccaactagatatggatctattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||| | | ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36283919 |
cattcatacctgaattattgtgcaggctgattgtgataataatatttattcaaattagcacttttagtaagcaatttccaactagatatggatctattaa |
36284018 |
T |
 |
| Q |
118 |
aaaaggatcaaagagtgacaaaggctgctgctcaagtaccaaacaattgttgagcaatttattaaaactattaatagaggcttatagattt |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36284019 |
aa-aggatcaaagagtgacaaaggctgctgctcaagtaccaaacaattgttgagaaatttattaaaactatgaatagaggcttatagattt |
36284108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 126 - 208
Target Start/End: Original strand, 40571712 - 40571794
Alignment:
| Q |
126 |
caaagagtgacaaaggctgctgctcaagtaccaaacaattgttgagcaatttattaaaactattaatagaggcttatagattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40571712 |
caaagagtgacaaaggctgctgctcaagtaccaaacaattattgagaaatttattaaaactattaatagaggcttatagattt |
40571794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 126 - 208
Target Start/End: Original strand, 19913218 - 19913300
Alignment:
| Q |
126 |
caaagagtgacaaaggctgctgctcaagtaccaaacaattgttgagcaatttattaaaactattaatagaggcttatagattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913218 |
caaagagtgacaaaggctgctgctcaagtaccaaacaattattgagaaatttattaaaactattaatagaggcttatagattt |
19913300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0130 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: scaffold0130
Description:
Target: scaffold0130; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 116 - 208
Target Start/End: Original strand, 18251 - 18343
Alignment:
| Q |
116 |
aaaaaaggatcaaagagtgacaaaggctgctgctcaagtaccaaacaattgttgagcaatttattaaaactattaatagaggcttatagattt |
208 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
18251 |
aaaaaaggaacaaagagtgaaaaaggcgactgctcaagtaccaaacaattgttgagcaattcattaaaactagtaatagaggcttatagattt |
18343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University