View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1875_high_7 (Length: 292)
Name: NF1875_high_7
Description: NF1875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1875_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 282
Target Start/End: Complemental strand, 15307895 - 15307844
Alignment:
| Q |
231 |
tctgagattgttcttgatcagtctagtccgttttttgttcatcctgatgatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
15307895 |
tctgagattgttcttgatcagtctagtccattttttgttcaccctggtgatg |
15307844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 282
Target Start/End: Complemental strand, 15313189 - 15313138
Alignment:
| Q |
231 |
tctgagattgttcttgatcagtctagtccgttttttgttcatcctgatgatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
15313189 |
tctgagattgttcttgatcagtctagtccattttttgttcaccctggtgatg |
15313138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University