View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1875_low_13 (Length: 215)
Name: NF1875_low_13
Description: NF1875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1875_low_13 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 47837231 - 47837045
Alignment:
| Q |
14 |
atgaagtagactgacatttggggttctgaaatgttatgttttggtgagaagatttgaacaaacatggccgaaatcgtttgatgcagttatgatgcaagca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47837231 |
atgaagtagactgacatttggggttctgaaattttatattttggtgagaagatttgaacaaacatggccgaaattgtttgatgcagttatgatgcaagca |
47837132 |
T |
 |
| Q |
114 |
tacaagtgatttaagatcacactgcaattgcgatgacgatgtagaggctaccacatcagcgatattagcggtcgcagttgcagatgt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47837131 |
tacaagtgattttagatcacactgcaattgcgatgacgatgtagaggctaccacatcagcgatattagcggtcgcagttgcagatgt |
47837045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 54 - 143
Target Start/End: Original strand, 38750795 - 38750884
Alignment:
| Q |
54 |
ttggtgagaagatttgaacaaacatggccgaaatcgtttgatgcagttatgatgcaagcatacaagtgatttaagatcacactgcaattg |
143 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| |||||||||| ||||| | |||||| |||||| ||||||||| ||| |||| |
|
|
| T |
38750795 |
ttggtgagaagatttgaacaaacattaccaaaatcgtgtgatgcagttccgatgcgaccatacacgtgattgaagatcacaatgctattg |
38750884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 145
Target Start/End: Original strand, 49885 - 49972
Alignment:
| Q |
58 |
tgagaagatttgaacaaacatggccgaaatcgtttgatgcagttatgatgcaagcatacaagtgatttaagatcacactgcaattgcg |
145 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | ||||||||| ||||| |||||| ||||| ||||| ||||| || ||||| |
|
|
| T |
49885 |
tgagaaggtttgaacaaacatggccgaaatcgtgttatgcagttacgatgcgcccatacacatgattgaagataacactacacttgcg |
49972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University