View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18761_high_12 (Length: 250)
Name: NF18761_high_12
Description: NF18761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18761_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 6971545 - 6971769
Alignment:
| Q |
13 |
aatatccaaataataatttataggagtaaatcaatgggcttttgcaaaccactttatttgttaatagatatccaattaagaa---ataaaacagataaat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
6971545 |
aatatccaaataataatttataggagtaaatcattgggcttttgcaaaccactttgtttgttaatagatatccaattaagaagaaataaaac-gataaat |
6971643 |
T |
 |
| Q |
110 |
attgaagcatggaatttagaatgatttagaatgattttatatgaaaatcgtgcaacaatagttgaatggataggcaagaaggagcagtcatgcttgaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971644 |
attgaagcatggaatttagaatgatttagaatgattttatatgaaaatcgtgcaacaatagttgaatggataggcaagaaggagcagtcatgcttgaatt |
6971743 |
T |
 |
| Q |
210 |
ttaataagtggatgtattgaggaaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6971744 |
ttaataagtggatgtattgaggaaac |
6971769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University