View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18761_low_14 (Length: 242)
Name: NF18761_low_14
Description: NF18761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18761_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 45651231 - 45651123
Alignment:
| Q |
121 |
aacacgatcttaaaataaagtatttgaagagataataattggttaagatagagactaagttatctatcaaagtcattgaaatttaaagatatgaaacgtt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
45651231 |
aacacgatcttaaaataaagtatttgaagagataaaaattgattaagatagagactaagttatctatcaaagtcactgaaattcaaagatatgaaacgtt |
45651132 |
T |
 |
| Q |
221 |
gttcggtct |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
45651131 |
gttcggtct |
45651123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University