View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18761_low_15 (Length: 240)

Name: NF18761_low_15
Description: NF18761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18761_low_15
NF18761_low_15
[»] chr5 (2 HSPs)
chr5 (30-154)||(38459560-38459684)
chr5 (155-192)||(38459504-38459541)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 38459684 - 38459560
Alignment:
30 cagatgttgatttcaacttatgtcagaagtttttattcgaaaatcttggtcattgtaagatcatacaaaaacttctgatttcacacatacttatttgaaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38459684 cagatgttgatttcaacttatgtcagaagtttttattcgaaaatcttggtcattgtaagatcatacaaaaacttctgatttcacacatacttatttgaaa 38459585  T
130 aaattattttaggttactctaaaac 154  Q
    |||||||||||||||||||||||||    
38459584 aaattattttaggttactctaaaac 38459560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 38459541 - 38459504
Alignment:
155 gtgttattaaatagctgctacagcgccgctatactgct 192  Q
    ||||||||||||||||||||||||||||||||||||||    
38459541 gtgttattaaatagctgctacagcgccgctatactgct 38459504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University