View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18761_low_15 (Length: 240)
Name: NF18761_low_15
Description: NF18761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18761_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 38459684 - 38459560
Alignment:
| Q |
30 |
cagatgttgatttcaacttatgtcagaagtttttattcgaaaatcttggtcattgtaagatcatacaaaaacttctgatttcacacatacttatttgaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38459684 |
cagatgttgatttcaacttatgtcagaagtttttattcgaaaatcttggtcattgtaagatcatacaaaaacttctgatttcacacatacttatttgaaa |
38459585 |
T |
 |
| Q |
130 |
aaattattttaggttactctaaaac |
154 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38459584 |
aaattattttaggttactctaaaac |
38459560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 38459541 - 38459504
Alignment:
| Q |
155 |
gtgttattaaatagctgctacagcgccgctatactgct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38459541 |
gtgttattaaatagctgctacagcgccgctatactgct |
38459504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University