View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18761_low_6 (Length: 423)
Name: NF18761_low_6
Description: NF18761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18761_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 1 - 415
Target Start/End: Complemental strand, 54014910 - 54014496
Alignment:
| Q |
1 |
tctactacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014910 |
tctactacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaa |
54014811 |
T |
 |
| Q |
101 |
gaatgggactggtaattcaacattttatcatttaacaaagtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014810 |
gaatgggactggtaattcaacattttatcatttaacaaagtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaa |
54014711 |
T |
 |
| Q |
201 |
cagggacaatttcttgattcttcaaacactcgttgctaccttagtttcctatattttcccatttcttcagcatcttcctctatggaatataaaaggtatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54014710 |
cagggacaatttcttgattcttcaaacacttgttgctaccttagtttcctatattttcccatttcttcagcatcttcctctatggaatgtaaaaggtatt |
54014611 |
T |
 |
| Q |
301 |
attgttgccatgattctacatgtgggagtttcagagccactttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctc |
400 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014610 |
attgttgctatgattctacatgtgggagtttcagagccactttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctc |
54014511 |
T |
 |
| Q |
401 |
ttcatcattcatctc |
415 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54014510 |
ttcatcattcatctc |
54014496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University