View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_high_15 (Length: 324)
Name: NF18763_high_15
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 14 - 318
Target Start/End: Original strand, 12993151 - 12993461
Alignment:
| Q |
14 |
atatcacgtgcgttctcactataagcgagaacgcgaaaagaaggttcatcaacagcgatcattgaaccaaaaggttgaatgaaaccgccacgttggattt |
113 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12993151 |
atatcacgtgcgttctcgctataagccagaacgcgaaaagaaggttcatcaacagcgatcattgaaccaaaaggttgaataaaaccgccacgttggattt |
12993250 |
T |
 |
| Q |
114 |
tggctaagtaagcagtgatctgttgttcaggtacggattgagagtgggcagctgtagtaagacggatggattgagagtaatcgaaagagtcgccggattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12993251 |
tggctaagtaagcagtgatctgttgttcaggtacggattgagagtgggcagctgtagtaagacggatggattgagagtaatcgaaagagtcgccggattg |
12993350 |
T |
 |
| Q |
214 |
ttcgaaaacggcgtggagacgtgcgtcttcagtgtattgtgcaattgcttttttcattgat------ttattgttgttttgttgttcaggttcttttgta |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
12993351 |
ttcgaaaacggcgtggagacgtgcgtcttcagtgtattgtgcaattgcttttttcattgatttgttgttgttgttgttttgttgttcaggttcttttgta |
12993450 |
T |
 |
| Q |
308 |
gtagtgatttg |
318 |
Q |
| |
|
||||||||||| |
|
|
| T |
12993451 |
gtagtgatttg |
12993461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University