View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_high_24 (Length: 260)
Name: NF18763_high_24
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_high_24 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 51310592 - 51310703
Alignment:
| Q |
9 |
agatgaagaaggtggagccggatcggtggaggagctggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310592 |
agatgaagaaggtggagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata |
51310691 |
T |
 |
| Q |
109 |
gggacggggacg |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51310692 |
gggacggggacg |
51310703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 179 - 260
Target Start/End: Original strand, 35047572 - 35047653
Alignment:
| Q |
179 |
ggatagagcatgaggcaaggaaccatggaagaannnnnnncttatgaataagaaaccatgaaaaatgttgcgaaagaaaata |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35047572 |
ggatagagcatgaggcaaggaaccatggaagaatttttttcttatgaacaagaaaccatgaaaaatgttgcgaaagaaaata |
35047653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University