View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_high_27 (Length: 240)
Name: NF18763_high_27
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_high_27 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 158 - 240
Target Start/End: Original strand, 242412 - 242494
Alignment:
| Q |
158 |
tttatgtttatcatttctagtggtacacattctacaattagactctgatgatagagagacactctcaattcattactctatgt |
240 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
242412 |
tttatgtttatcatttgtagtggtacacattctacaattagactctgatgatagagagacactgtcaattcaatactctatgt |
242494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 84 - 150
Target Start/End: Original strand, 242247 - 242313
Alignment:
| Q |
84 |
cttcaagggggagtaggacttgattgtgattttgcttttaggttgttgttgttgtaatgagaatgaa |
150 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242247 |
cttcaagtgggagtaggacttgattgtgattttgcttttaggttgttgttgttgtaatgagaatgaa |
242313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 6927141 - 6927203
Alignment:
| Q |
177 |
gtggtacacattctacaattagactctgatgatagagagacactctcaattcattactctatgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| ||| ||||||| |||||||||| |
|
|
| T |
6927141 |
gtggtacacattctacaattagactctgatgagag-gagatactgtcaattccatactctatgt |
6927203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University