View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_22 (Length: 288)
Name: NF18763_low_22
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 39293007 - 39292792
Alignment:
| Q |
1 |
aatcaaacgaaaatgaaagaatttgtctatgacaccacactcgccaacagctttttggagcattaagtttcatcattgagagagcttttcatagttcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39293007 |
aatcaaacgaaaatgaaagaatttgtctatgacaacacactcgccgacagctttttggagcattaagtttcatcattgagagagcttttcatagtccaag |
39292908 |
T |
 |
| Q |
101 |
aaaattaagataagtaaacacactagagagagatatggctgccaataatgaaaagaaagagcaaaacattcatctccctcacgaaactatccttaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39292907 |
aaaattaagataagtaaacacactagagagagatatggctgccaataatgaaaagaaagagcaaaacattcatctccctcacgaaactatccttaagagt |
39292808 |
T |
 |
| Q |
201 |
gatgcactacatcagg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39292807 |
gatgcactacatcagg |
39292792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 238 - 280
Target Start/End: Complemental strand, 39292782 - 39292740
Alignment:
| Q |
238 |
ctactattcttttccatcttcttctaccgtaaatattcttcga |
280 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
39292782 |
ctactattcttttccttcttcttctaccgtaaatcttgttcga |
39292740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University