View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_24 (Length: 279)
Name: NF18763_low_24
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 21 - 263
Target Start/End: Original strand, 39987194 - 39987436
Alignment:
| Q |
21 |
aactgataattactctttctcaccctcccatgattacttcaactttgaactttccgctaactcttggtcacaaaacatcctccttgaaactgcacgtgca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987194 |
aactgataattactctttctcaccctcccatgattacttcaactttgaattctccggtcactcttggtcacaaaacatcctccttgaaactgcacgtgca |
39987293 |
T |
 |
| Q |
121 |
ttttccgacaatcacacaaaccgaatccaacaactcatgtggatgctaaacgagcttagtaccccatatggtgacacagatcaaaaactttcatcttatt |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987294 |
ttttccgacaataacacaaaccgaatccaacaactcatgtggatgctaaacgagcttagtaccccatatggtgacacagatcaaaaactttcatcttatt |
39987393 |
T |
 |
| Q |
221 |
ttcttcaagctttgtttagtcgcatgaacgacgcgggagatag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987394 |
ttcttcaagctttgtttagtcgcatgaacgacgcgggagatag |
39987436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 5366013 - 5365952
Alignment:
| Q |
148 |
caacaactcatgtggatgctaaacgagcttagtaccccatatggtgacacagatcaaaaact |
209 |
Q |
| |
|
|||||||||||||||||||| ||||| || || |||| |||||||||| ||| |||||||| |
|
|
| T |
5366013 |
caacaactcatgtggatgcttaacgaactaagctccccttatggtgacatagaacaaaaact |
5365952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University