View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18763_low_27 (Length: 260)

Name: NF18763_low_27
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18763_low_27
NF18763_low_27
[»] chr3 (1 HSPs)
chr3 (9-120)||(51310592-51310703)
[»] chr6 (1 HSPs)
chr6 (179-260)||(35047572-35047653)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 51310592 - 51310703
Alignment:
9 agatgaagaaggtggagccggatcggtggaggagctggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata 108  Q
    |||||||||||||||||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51310592 agatgaagaaggtggagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata 51310691  T
109 gggacggggacg 120  Q
    ||||||||||||    
51310692 gggacggggacg 51310703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 179 - 260
Target Start/End: Original strand, 35047572 - 35047653
Alignment:
179 ggatagagcatgaggcaaggaaccatggaagaannnnnnncttatgaataagaaaccatgaaaaatgttgcgaaagaaaata 260  Q
    |||||||||||||||||||||||||||||||||       |||||||| |||||||||||||||||||||||||||||||||    
35047572 ggatagagcatgaggcaaggaaccatggaagaatttttttcttatgaacaagaaaccatgaaaaatgttgcgaaagaaaata 35047653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University