View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_29 (Length: 245)
Name: NF18763_low_29
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 26917140 - 26916931
Alignment:
| Q |
17 |
aatatcatctttaagcagtacaagattgatcaggtgcagatacttacttggttccataaccttgagcagtatttaacttaaccgtgtgaattactccatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26917140 |
aatatcatctttaagcagtacaagattgatcaggtgcagatacttacttggttccataaccttgagcagtatttaacttaaccgtgtgaattactccatc |
26917041 |
T |
|
| Q |
117 |
tgtttcttgattaatgctccatttttaaatattgcattttgttgagtaaatgataaaaattaacaaagttgatagtagtaataaaaacatgattttagaa |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26917040 |
tgtttcttgattaatgctccattcttaaatattgcattttgttgagtaaatgataaaaattaacaaagttgatagtagtaataaaaacatgattttagaa |
26916941 |
T |
|
| Q |
217 |
atgatatatg |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
26916940 |
atgatatatg |
26916931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University