View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_30 (Length: 242)
Name: NF18763_low_30
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 235
Target Start/End: Original strand, 52863396 - 52863623
Alignment:
| Q |
6 |
aactttatttgattttttgctatagaaataagttgtgtttatcctcctggtttcaattctttaaaacttaaatatctcgaattacattcaaattatcacc |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52863396 |
aactttatttgatcttttgctatagaaataagttgt--ttatcctcctggtttcaattctttaaaacttaaatatctctaattacattcaaattatcacc |
52863493 |
T |
|
| Q |
106 |
atttttgtgaagctaaactcattgatgttacacaaaataactggctggcagggatgaattctgggacctgttcaagaattatttttatcaaccgatgatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52863494 |
atttttgtgaagctaaactcattgatgttacacaaaataactggctggcagggatgaattctgggacctgttcaagaattatttttatcaaccgatgatc |
52863593 |
T |
|
| Q |
206 |
aagggtgatctgcgcatctgtctctacggt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52863594 |
aagggtgatctgcgcatctgtctctacggt |
52863623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 74
Target Start/End: Original strand, 52863367 - 52863400
Alignment:
| Q |
41 |
tgtttatcctcctggtttcaattctttaaaactt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52863367 |
tgtttatcctcctggtttcaattctttaaaactt |
52863400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9656635 - 9656600
Alignment:
| Q |
1 |
aatttaactttatttgattttttgctatagaaataa |
36 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9656635 |
aatttaactttattttattttttgctatagaaataa |
9656600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University