View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_35 (Length: 236)
Name: NF18763_low_35
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 40179671 - 40179473
Alignment:
| Q |
17 |
acaatgttggatttcttagcatttggtgctttgaatgcactgttaaccatatttccattcatgtttgtctcattgttttcctcctcagtgctccattcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40179671 |
acaatgttggatttcttagcatttggtgctttgaatggactgttaaccata---------atgtttgtctcattgttttcctcctcagtgctccattcca |
40179581 |
T |
 |
| Q |
117 |
ttttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcacaccttcaactggatcaccatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40179580 |
ttttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcacaccttcaacttgatcaccatt |
40179481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University