View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18763_low_37 (Length: 224)
Name: NF18763_low_37
Description: NF18763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18763_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 31950503 - 31950695
Alignment:
| Q |
18 |
atggataaacataaaatgtgtcttaagtcaaatagtaatttgtctatgtttacaaagattaattgaaataaaataaaggaagtaaataaacaaaaagctg |
117 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31950503 |
atggataaacataaagtgtgt-ttaagtcaaatagtaatttgtctatgtttacaaagattaattgaaataaaataaaggaagtaaataaacaaaaagcag |
31950601 |
T |
 |
| Q |
118 |
ctatagatat-aagtctttgagcaactctccaagaactcatcttt--gcaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31950602 |
ctatagatatcaagtctttgagcaactctccaagaactcatctttggggaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
31950695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 121 - 208
Target Start/End: Original strand, 55319411 - 55319503
Alignment:
| Q |
121 |
tagatataagtctttgagcaactctccaagaactca-----tctttgcaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55319411 |
tagatataagtctttgagcaactctccaagaactcaactcgtctttgcaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
55319503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 20632904 - 20632840
Alignment:
| Q |
144 |
ctccaagaactcatctttgcaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20632904 |
ctccaagaactcatctttggaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
20632840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 55319361 - 55319412
Alignment:
| Q |
18 |
atggataaacataaaatgtgtcttaagtcaaatagtaatttgtctatgttta |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55319361 |
atggataaacataaaatgtgtcttaagtcaaatagtaatttgtctatgttta |
55319412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 70 - 173
Target Start/End: Complemental strand, 2779572 - 2779468
Alignment:
| Q |
70 |
caaagattaattgaaataaaataaaggaagtaaataaacaaaaagctgctatagatat-aagtctttgagcaactctccaagaactcatctttgcaatag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
2779572 |
caaagattaattgaaataaaataaaggaagtaaataaacaaaaagctgatatagagatcaagtctttgagaaactctccaagaactcatctttggaatag |
2779473 |
T |
 |
| Q |
169 |
cttcc |
173 |
Q |
| |
|
||||| |
|
|
| T |
2779472 |
cttcc |
2779468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 31959300 - 31959220
Alignment:
| Q |
128 |
aagtctttgagcaactctccaagaactcatctttgcaatagcttccctgtgccgctttccaaccacacaaccagtgcaaat |
208 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||| ||||| |||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
31959300 |
aagtctttgagaaactctccaagaactcttctttggaatagattccctgtgctgctttccaaccacacaacaagtgcaaat |
31959220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University