View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18764_high_12 (Length: 335)
Name: NF18764_high_12
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18764_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 156 - 319
Target Start/End: Original strand, 1253574 - 1253741
Alignment:
| Q |
156 |
aacataatgagaatttagcaggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattcacctaaggatagaaacatataattc |
255 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253574 |
aacataatgagaatttagcgggatgttacactctatcccactaaagaaaatttcgttctcgaaatttagaaattcacctaaggatagaaacatataattc |
1253673 |
T |
 |
| Q |
256 |
ctctacacttccagccttggtttccaacacgcgttctctactat----ctgtctcgatccaactgact |
319 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
1253674 |
ctctacactttcagccttggtttccaacacgcgttctctactatccgactctctcgatccaactgact |
1253741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 230
Target Start/End: Complemental strand, 2441 - 2387
Alignment:
| Q |
176 |
ggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattc |
230 |
Q |
| |
|
|||| |||||||||| |||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
2441 |
ggatattacactctaccccccttaaagaaatttcgtcctcgaaatttagagattc |
2387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University