View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18764_high_22 (Length: 240)
Name: NF18764_high_22
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18764_high_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 240
Target Start/End: Original strand, 7307909 - 7307987
Alignment:
| Q |
162 |
aatctcaacttaccatacacatacgaggatcctaacactattcataatagaggcaacatgacaacttcgaattactcaa |
240 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| |||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
7307909 |
aatctcaaccaaccatacacatacaaggatcccaacaccattcataacagaggcaatgagacaacttcgatttactcaa |
7307987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 13245400 - 13245438
Alignment:
| Q |
1 |
catagggaattaagactaaccccacaaatacagggatgg |
39 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13245400 |
catagggaattaagactaaccccacaaacacagggatgg |
13245438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University