View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18764_low_20 (Length: 247)
Name: NF18764_low_20
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18764_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 76 - 239
Target Start/End: Complemental strand, 16753511 - 16753338
Alignment:
| Q |
76 |
ctgcatgtagagaaggaatgatagaacaaaaagacagcgactacaagttcaattgtttggttaagagatgaaaacattaacatatggttgggaa------ |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16753511 |
ctgcatgtagagaaggaatgatagaacagaaagacagcgactacaagttcaattg-ttggttaagaaattaaaacattaacatatggttgggaacgtttg |
16753413 |
T |
 |
| Q |
170 |
----ctcttttgtaattttcaacctcctatcttcctc-aaggaacaactcataaaccgaaaagaaagaccctttg |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16753412 |
attcctctcttgtaattttcaacctcctatcttcctctaaggaacaactcataaacctaaaagaaagaccctttg |
16753338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University