View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18764_low_22 (Length: 240)

Name: NF18764_low_22
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18764_low_22
NF18764_low_22
[»] chr3 (1 HSPs)
chr3 (25-222)||(17003838-17004035)
[»] chr5 (1 HSPs)
chr5 (1-29)||(9827778-9827806)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 17003838 - 17004035
Alignment:
25 aatatatgcagggtccgagttttgaacaccggacgccccagttattaaccttaagggtatgtactaagaaaaatggatagaggtagtattattcttttaa 124  Q
    |||||||||||| |||||| |||||||||||||| ||||| ||||||||||||| ||||| |||||| ||||| ||||||||||||||||||||||||||    
17003838 aatatatgcaggatccgaggtttgaacaccggacaccccacttattaaccttaaaggtatatactaataaaaagggatagaggtagtattattcttttaa 17003937  T
125 tttgtggttttggatagtaaaaaggatttcaccttgagctattggtgaatatgcaatcaatgtaatcccaagttcatcacaggctttcttcacaccat 222  Q
    | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17003938 tatgtggttttgaatagtaaaaaggatttcaccttgagctattggtgaatatgcaatcaatgtaatcccaagttcatcacaggctttcttcacaccat 17004035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 9827806 - 9827778
Alignment:
1 cttaatggtacacaagtggaatccaatat 29  Q
    |||||||||||||||||||||||||||||    
9827806 cttaatggtacacaagtggaatccaatat 9827778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University