View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18764_low_22 (Length: 240)
Name: NF18764_low_22
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18764_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 17003838 - 17004035
Alignment:
| Q |
25 |
aatatatgcagggtccgagttttgaacaccggacgccccagttattaaccttaagggtatgtactaagaaaaatggatagaggtagtattattcttttaa |
124 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||||| ||||||||||||| ||||| |||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
17003838 |
aatatatgcaggatccgaggtttgaacaccggacaccccacttattaaccttaaaggtatatactaataaaaagggatagaggtagtattattcttttaa |
17003937 |
T |
 |
| Q |
125 |
tttgtggttttggatagtaaaaaggatttcaccttgagctattggtgaatatgcaatcaatgtaatcccaagttcatcacaggctttcttcacaccat |
222 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17003938 |
tatgtggttttgaatagtaaaaaggatttcaccttgagctattggtgaatatgcaatcaatgtaatcccaagttcatcacaggctttcttcacaccat |
17004035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 9827806 - 9827778
Alignment:
| Q |
1 |
cttaatggtacacaagtggaatccaatat |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9827806 |
cttaatggtacacaagtggaatccaatat |
9827778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University