View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18764_low_26 (Length: 238)
Name: NF18764_low_26
Description: NF18764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18764_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 77 - 221
Target Start/End: Original strand, 16753677 - 16753821
Alignment:
| Q |
77 |
aatattgactattatcataaaaacatataacatagtcattttgcaagattttgaggtaataacttcattagtcgttcatcttggattagtttttgttaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16753677 |
aatattgactattatcataaaaacatataacatagtcattttacaagattttgaggcaataacttcattagtcgttcatcttggattagtttttgttaat |
16753776 |
T |
|
| Q |
177 |
catgtttcaccaatacttgttggaaatttaacaacgaggactaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16753777 |
catgtttcaccaatacttgttggaaatttaacaacgaggactaaa |
16753821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University