View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_high_11 (Length: 337)
Name: NF18765_high_11
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 56371920 - 56371626
Alignment:
| Q |
19 |
atatgtatgtctctctctgcaacacatggaaatgtaatgttggcaatggaatgcatcattctaattctatgtggacaacaa-cttttgtctttccgtgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
56371920 |
atatgtatgtctctctctgcaacacatgcaaatgtaatgttggcaatggcatgcatcattctaattctatg--gacaacaaacttttgtctttccgtgta |
56371823 |
T |
|
| Q |
118 |
ataagaggaaaggatcattttacactctttcttactttgaaannnnnnnnnnnnnnnnnnnnnntgcatgtgcaatgttgcaggaattaatggggtaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
56371822 |
ataagaggaaaggatcattttacactctttcttactttgaaaagcagcagcagca---------tgcatgtgcaatgttgcaggaattaatggg-taatt |
56371733 |
T |
|
| Q |
218 |
ggtttggttccttaagcttcaaatgttgtaatgtttctttctttccttccaatcttagatagaggatcatcccaaaaactgtcagattggactatcattt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56371732 |
ggtttggttccttaagcttcaaatgttgtaatgtttctttctttccttccaatcttagatagaggatcatccc-aaaactgtcagattggactatcattt |
56371634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University