View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_high_16 (Length: 249)
Name: NF18765_high_16
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41876846 - 41877068
Alignment:
| Q |
1 |
aaactcaatagaaaaatgcaagttgaagcaactcaaatcgggaacnnnnnnnnngtgtttagtttggatgtgttcataccaattttttacactcgaccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
41876846 |
aaactcaatagaaaaatgcaagttgaagcaactcaaatcgggaa---aaaaaaagtgtttagtttggatgtgttcataccaatttt--acactcaaccac |
41876940 |
T |
 |
| Q |
101 |
gtggttcaccgtctctttgtagtattgaatttatctactttatgattctgctaggaaggggactcaaggatgcaagagctatgctaagctgaccacaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41876941 |
gtggttcaccgtctctttgtagtattgaatttatctactttatgattctgctaggaaggggactcaaggatgcaagagctatgctaagctgaccacaa-- |
41877038 |
T |
 |
| Q |
201 |
aaagtctaaaggatctataaccactattacgcgcc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41877039 |
-----ctaaaggatctataaccactattacgcgcc |
41877068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University