View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_low_12 (Length: 375)
Name: NF18765_low_12
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_low_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 14 - 375
Target Start/End: Original strand, 35116786 - 35117147
Alignment:
| Q |
14 |
aaatggtgcaattccgaatcaattctagactcatcgccatcggatccaaaactttgtcttgagggcgactgatcagaactctgcatatcacacacatttt |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35116786 |
aaatggtgcaactccgaatcaattctagactcatcgccatcggatccaaaactttgtcttgagggcgactgatcagaactctgcatatcacacacatttt |
35116885 |
T |
 |
| Q |
114 |
cataaagctgctcgattgaaggctcaacaaccccatcatcctggaaattaggaccgacactttgacgtctctgcggactcattgaactccttggagactt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35116886 |
cataaagctgctcgattgaaggctcaacaaccccatcatcctggaaattaggaccgacactttgacgtctctgcgggctcattgaactccttggagactt |
35116985 |
T |
 |
| Q |
214 |
gattggagttaagcttgccttagtgggcgaacggttcccattcatctcattaacttccccatcgtcatgaaccccgtttgtaacaattcccggcatcttt |
313 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35116986 |
gattggagttaagcttgccttagtgggagaacggttcccattcatctcattaacttccccatcgtcatgaaccccgtttgtaacaattcccggcatcttt |
35117085 |
T |
 |
| Q |
314 |
aattctctcagaggatccagaatccctgtgacaacaaatatcaaatacatgatctacaaaat |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35117086 |
aattctctcagaggatccagaatccctgtgacaacaaatatcaaacacatgatctacaaaat |
35117147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University