View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_low_17 (Length: 259)
Name: NF18765_low_17
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 11826633 - 11826584
Alignment:
| Q |
118 |
atacaatggtgatgttggcttgagatcttgaagtgtcatcactttgaagt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11826633 |
atacaatggtgatgttggcttgagatcttgaagtgtcctcactttgaagt |
11826584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University