View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_low_19 (Length: 239)
Name: NF18765_low_19
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 5 - 153
Target Start/End: Original strand, 24062353 - 24062501
Alignment:
| Q |
5 |
caaaaagacaatctaggatatggttgtcattttagtgatcacacaccactagtcgtctcaagggataaaactctcttggagtacgcgtatgctgaattta |
104 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062353 |
caaaaagacaatcgaggacatggttgtcattttagtgatcacacaccactagtcgtctcaagggataaaactctcttggagtacgcgtatgctgaattta |
24062452 |
T |
 |
| Q |
105 |
aataagctagaatcaaattccccaaagcaactgcactaaaattcgggga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24062453 |
aataagctagaatcaaattccccaaagcaactgcactaaaatttgggga |
24062501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 156 - 226
Target Start/End: Original strand, 24062534 - 24062604
Alignment:
| Q |
156 |
accaaatgcacgttactaatgattgaatacaccaaaaggatgccctcgagatcctcatctaacgaggaaat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062534 |
accaaatgcacgttactaatgattgaatacaccaaaaggatgccctcgagatcctcatctaacgaggaaat |
24062604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University