View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18765_low_23 (Length: 208)
Name: NF18765_low_23
Description: NF18765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18765_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 30128517 - 30128719
Alignment:
| Q |
1 |
ctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggnnnnnnnnnnn--gtatcgatgttttgccagtttcagcatcccagtagtggttg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30128517 |
ctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggttgttttttttttgtatcgatgttttggtagtttcagcatcctagtagtggttg |
30128616 |
T |
 |
| Q |
99 |
ttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatttccctgtgtggcaagattggtgcatctcgtgcaggttttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30128617 |
ttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatttccctgtgtggcaagattggtgcatctcgtgcaggttttg |
30128716 |
T |
 |
| Q |
199 |
ctt |
201 |
Q |
| |
|
||| |
|
|
| T |
30128717 |
ctt |
30128719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University