View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18766_high_32 (Length: 252)

Name: NF18766_high_32
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18766_high_32
NF18766_high_32
[»] chr7 (4 HSPs)
chr7 (13-240)||(24154053-24154280)
chr7 (35-119)||(21199708-21199792)
chr7 (37-101)||(24121948-24122012)
chr7 (37-82)||(24238277-24238322)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 24154280 - 24154053
Alignment:
13 gaagaatatctatggaataaagcttgcaaagaaatgctaatcaagccaaggaactcaatggaagcttattgtcaacaactcaaactgaacatcgacgaaa 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||    
24154280 gaagaatatctatggaataaagcttgcaaagaaatgctaatcaagccagggaactcaatggaagcttattgtcatcaactcaaactgaacatcgacgaaa 24154181  T
113 cagaacccttgcagaacttatgcaagcgttacctttgtcctctaccagggaacattgtgagcattttttgcaatcagaaatgcaaatgtggaatgcttta 212  Q
    |||||||||||||| |||||||| ||  |    |||||| | ||    |||||| |  ||||||||||| ||| |||||||||||||||||||||||||     
24154180 cagaacccttgcagtacttatgcgagtatcctttttgtcgtttagttaggaacagttggagcattttttacaaacagaaatgcaaatgtggaatgctttt 24154081  T
213 taactcaggtcctgtcgttattgatgat 240  Q
    ||||||||||||||||||||| ||||||    
24154080 taactcaggtcctgtcgttatcgatgat 24154053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 35 - 119
Target Start/End: Original strand, 21199708 - 21199792
Alignment:
35 cttgcaaagaaatgctaatcaagccaaggaactcaatggaagcttattgtcaacaactcaaactgaacatcgacgaaacagaacc 119  Q
    ||||||| ||||||||| || |||||||||| || |||||||||||||||||  |  | |||||||| |||||||| ||||||||    
21199708 cttgcaaggaaatgctactcgagccaaggaattccatggaagcttattgtcagaagatgaaactgaatatcgacgacacagaacc 21199792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 37 - 101
Target Start/End: Complemental strand, 24122012 - 24121948
Alignment:
37 tgcaaagaaatgctaatcaagccaaggaactcaatggaagcttattgtcaacaactcaaactgaa 101  Q
    ||||||||||||||| |||| || || ||||||||||| || ||||||||||| |||||||||||    
24122012 tgcaaagaaatgctactcaaccctagaaactcaatggaggcgtattgtcaacagctcaaactgaa 24121948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 82
Target Start/End: Original strand, 24238277 - 24238322
Alignment:
37 tgcaaagaaatgctaatcaagccaaggaactcaatggaagcttatt 82  Q
    ||||| ||||||||| |||||||||||||||| ||||||| |||||    
24238277 tgcaaggaaatgctactcaagccaaggaactccatggaagtttatt 24238322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University