View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_high_35 (Length: 234)
Name: NF18766_high_35
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 54220921 - 54220728
Alignment:
| Q |
20 |
atcaagaggggtgtttcgatcacctttccacccactcgcattccttcaactattgtgtacatggcttgtggaggttttggtgctgcttgtgcagagaata |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54220921 |
atcaaaaggggtgtttcgatcacctttccacccactcgcattccttcaactattgtgtacatggcttgtggaggttttggtgctgcttgtgcagagaata |
54220822 |
T |
|
| Q |
120 |
gaccatttgggttgtcgacaaattcacgcttcctttcctttccgggcggagctcccaccttgaattcatatggctttcaagagtataaagcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54220821 |
gaccatttgggttgtcgacaaattcacgcttcctttcctttccgggcggagctcccaccttgaattcatatggctttcaagagtataaagcagg |
54220728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University