View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_low_23 (Length: 357)
Name: NF18766_low_23
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 42042287 - 42042043
Alignment:
| Q |
1 |
ttattctcgttttctaatcaacttaattacaccccaagtcaaaaa--tatatcttcttaaacatagcttgcaacttgcaagcttaccttaaaacaaacaa |
98 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042287 |
ttattctcgttttctaatcaactta----caccccaagtcaaaaaaatatatcttcttaaacatagcttgcaacttgcaagcttaccttaaaacaaacaa |
42042192 |
T |
|
| Q |
99 |
gcacttgttaaggttctttctcgtcacacacgtgtgaaagtaaatcacgtgagaatggaaataaaaatgtagcgggaagcaacgttctcacacgtactca |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042191 |
gcacttgttaaggttctttcttgtcacacacgtgtgaaagtaaatcacgtgagaatggaaataaaaatgtagcgggaagcaacgttctcacacgtactca |
42042092 |
T |
|
| Q |
199 |
aacatttttagaattttagaatcaaaaacacacaacccaaactaactaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042091 |
aacatttttagaattttagaatcaaaaacacacaacccaaactaactaa |
42042043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 278 - 333
Target Start/End: Complemental strand, 42042037 - 42041982
Alignment:
| Q |
278 |
atagatgagaaattatgtatcccgatcatgatggggttttgcagcaatatggaggg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042037 |
atagatgagaaattatgtatcccgatcatgatggggttttgcagcaatatggaggg |
42041982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University