View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_low_27 (Length: 317)
Name: NF18766_low_27
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 45548927 - 45549215
Alignment:
| Q |
17 |
actagtgattgatgatatttttgaacaagtatgaattttgagttcctgccgtatcccctttcttttcatcacttcatagccgcaatctaatatcagcttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548927 |
actagtgattgatgatatttttgaacaagtatgaactttgagttcctgccgtatcccctttcttttcatcacttcatagccgcaatctaatatcagcttg |
45549026 |
T |
|
| Q |
117 |
ctactttggtcttgactgtcttgatgattaccttgaagaataccaaacgggatgtttagtctgaaaagtgcttctgcagtgttgacgaataattgactcg |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549027 |
ctacgttggtcttgactgtcttgatgattaccttgaagaataccgaacgggatgtttagtctgaaaagtgcttctgcagtgttgacgaataattgactcg |
45549126 |
T |
|
| Q |
217 |
tgaccaaaatccacttgaggtggttttcactttctgttagtggttgttggatgctcatcttttgattttgttgtttcacacccattctg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45549127 |
tgaccaaaatccacttgaggtggttttcactttctgttagtggttgttggatgctcatattttgattttgttgtttcacacccattctg |
45549215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University