View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_low_40 (Length: 242)
Name: NF18766_low_40
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 53 - 216
Target Start/End: Original strand, 51311125 - 51311292
Alignment:
| Q |
53 |
agggaagtcaatattttcttctttttggagaataaaaaggagggaggggacttt-----gcagatgaaagttcgaactgctcttttcgtatccactatcc |
147 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51311125 |
agggaagtcaatcttttcttctttttggagaataaaaaggagggaggggactttaatttgcagatgaaagttcgaactgctctttgcgtatccactatcc |
51311224 |
T |
 |
| Q |
148 |
cattatccaaggaggagtgggtaaaggacaggtgatgtaatgtaacatgctctcaatcgttggaagatg |
216 |
Q |
| |
|
||||||||||||||||||||||||| | ||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
51311225 |
cattatccaaggaggagtgggtaaa-taaaggacaggtgatgtaacatgctctcaatcgttggaagatg |
51311292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University