View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_low_42 (Length: 236)
Name: NF18766_low_42
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_low_42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 51310799 - 51311046
Alignment:
| Q |
1 |
atagttttttggataagaatatgttattatgaatcgtggtttgggattctttgtggatacgtgaaggaattacaaagaatgggtatgacgaagggaaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310799 |
atagttttttggataagaatatgttattatgaatcgtggtttgggattctttgtggatacgtgaaggaattacaaagaatgggtatgacgaagggaaggg |
51310898 |
T |
|
| Q |
101 |
aatttcattaacttaacttgcaaacttggatcctttgaggaat----agtggtaaaccatgtagaacgctttattat-ta-------cattacaatacac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| || | || ||||||| |
|
|
| T |
51310899 |
aatttcattaacttaacttgcaaacttggatcctttgaggaatagtgagtggtaaaccatgtagcacgctttattatatagcaagacccctaaaatacac |
51310998 |
T |
|
| Q |
189 |
gcaaaggttaatttttcttatctatttggagcttgtgctccactcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310999 |
gcaaaggttaatttttcttatctatttggagcttgtgctccactcttc |
51311046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University