View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18766_low_46 (Length: 226)

Name: NF18766_low_46
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18766_low_46
NF18766_low_46
[»] chr1 (1 HSPs)
chr1 (15-208)||(7039941-7040135)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 7039941 - 7040135
Alignment:
15 aatatgtcggtagagtgcataaaaatttggagactgggagtttgagagcctatatcatatttggttataatagaacgataagttcagtcggaaaatagta 114  Q
    ||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||| ||| | || ||||||||||    
7039941 aatatgtcggtggagtgcacaaaaatttggagactgagagtttgagagcctatatcagatttggttgtaatagaacgataggtttactcagaaaatagta 7040040  T
115 acaagaatggttataactaactatacagctacgtgtgtgtactatac-aaaaaagcttttcgaaagggcctgtatttataaataatggatgtgat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
7040041 acaagaatggttataactaactatacagctacgtgtgtgtactatacaaaaaaagctttccgaaagggcctgtatttataaataatggatgtgat 7040135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University