View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18766_low_46 (Length: 226)
Name: NF18766_low_46
Description: NF18766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18766_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 7039941 - 7040135
Alignment:
| Q |
15 |
aatatgtcggtagagtgcataaaaatttggagactgggagtttgagagcctatatcatatttggttataatagaacgataagttcagtcggaaaatagta |
114 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||| ||| | || |||||||||| |
|
|
| T |
7039941 |
aatatgtcggtggagtgcacaaaaatttggagactgagagtttgagagcctatatcagatttggttgtaatagaacgataggtttactcagaaaatagta |
7040040 |
T |
|
| Q |
115 |
acaagaatggttataactaactatacagctacgtgtgtgtactatac-aaaaaagcttttcgaaagggcctgtatttataaataatggatgtgat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7040041 |
acaagaatggttataactaactatacagctacgtgtgtgtactatacaaaaaaagctttccgaaagggcctgtatttataaataatggatgtgat |
7040135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University