View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18768_high_5 (Length: 365)
Name: NF18768_high_5
Description: NF18768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18768_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 14 - 349
Target Start/End: Complemental strand, 14393550 - 14393215
Alignment:
| Q |
14 |
aggcaagtaggcttcgaaaattatgcaatccaacccataggagtttgatttttatattagagggtttggcttcatatctttattttgagcgatgtgggac |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14393550 |
aggcaagtaggcttcgaaaattatgcgatccaaaccataggagtttgatttttatattagagggtttggcttcatatctttattttgaccgatgtgggac |
14393451 |
T |
|
| Q |
114 |
ttaagtccaacactattatctcttcaatgatccacatgcttttgttccttgatatatgttaatacacaattgatatcgtaaatgaagaacatcaacatca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14393450 |
ttaagtccaacactattatctcttcaatgatccacatacttttgttccttgatatatgttaatacacaattgatatcgtaaatgaagaacatcaacatca |
14393351 |
T |
|
| Q |
214 |
agactaagaaaatagttaaacatacagaattgtaattacaatgaattgtcgaaatataccttcagcttcacttccaaaatctgggggaacatgttttgcc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14393350 |
agactaagaaaatagttaaacatacagaattgtaattacaatgaattgtcgaaatataccttcagcttcacttccaaaatctgggggaacatgttttgcc |
14393251 |
T |
|
| Q |
314 |
gatggtttcaagcttagcaaaaatcattcagaaaat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14393250 |
gatggtttcaagcttagcaaaaatcattcagaaaat |
14393215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 52 - 149
Target Start/End: Complemental strand, 14396391 - 14396293
Alignment:
| Q |
52 |
aggagtttgatttttatattagagggtttg-gcttcatatctttattttgagcgatgtgggacttaagtccaacactattatctcttcaatgatccaca |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
14396391 |
aggagtttgatttttatattagagggttttagcttcatgtctttattttgagcgatgtggggcataagtctaacactattatctcttcaatgatccaca |
14396293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 14358302 - 14358346
Alignment:
| Q |
210 |
atcaagactaagaaaatagttaaacatacagaattgtaattacaa |
254 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
14358302 |
atcaagactaaagaaatatttaaacatacagaattgtaattacaa |
14358346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 52 - 119
Target Start/End: Complemental strand, 14390406 - 14390339
Alignment:
| Q |
52 |
aggagtttgatttttatattagagggtttggcttcatatctttattttgagcgatgtgggacttaagt |
119 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| ||| |||| | ||| |||||||||||| |||||| |
|
|
| T |
14390406 |
aggagttcgatttttatattagaggttttggcctcacgtcttgactttcagcgatgtgggatttaagt |
14390339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University