View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18768_high_7 (Length: 336)
Name: NF18768_high_7
Description: NF18768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18768_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 326
Target Start/End: Original strand, 226313 - 226619
Alignment:
| Q |
20 |
atcagtatatcaccatgtcactgccaccatcaagttccattcattttcaatagatctgaacacnnnnnnnnatggattgttcgaagttccatttagtgca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
226313 |
atcagtatatcaccatgtcactgccaccatcaagttccattcattttcaatagatctgaacacttttttttatggattgttcgaagtttcatttagtgca |
226412 |
T |
 |
| Q |
120 |
ggtttaatatcactgtggtttggcaagatagcagcgagttgtcgtggctcatcgtgattttgataaacccaccatgttactaaacatacatttaccatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226413 |
ggtttaatatcactgtggtttggcaagatagcagcgagttgtcgtggctcatcgtgattttgataaacccaccatgttactaaacatacatttaccatca |
226512 |
T |
 |
| Q |
220 |
agtatgatgaactatttggtaaatacaatcttaatgacagggttggaagctttttactaagacttcagagtataacatataatctatgtctatgttttta |
319 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226513 |
agtatgatgaactatttggcaaatacaatcttaatgacagggttggaagctttttaccaagacttcagagtataacatataatctatgtctatgttttta |
226612 |
T |
 |
| Q |
320 |
gcctttg |
326 |
Q |
| |
|
||||||| |
|
|
| T |
226613 |
gcctttg |
226619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University