View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18768_low_10 (Length: 226)
Name: NF18768_low_10
Description: NF18768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18768_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 50523737 - 50523932
Alignment:
| Q |
13 |
taaattattctatgataggtggaataattagtggatcgtttggtgaatgaaacaaggagctagtgccaatagctcatatggttaatgatatgtatgcatc |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50523737 |
taaattattctatgatcggtggaataattagtggatcgtttggtgaatgaaacaaggagctagtgccaatagctcatatggttaatgatatgtatgcatc |
50523836 |
T |
 |
| Q |
113 |
cctcattcaacttccttcctgttcgttctgcaagattctggtttacagcacaaattgatataattgaaaatttttgacactaatggaaggagtcac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50523837 |
cctcattcaacttccttcctgttcgttctgcaagattctggtttacagcacaaattgatataattgaaaatttttgacactaatggaaggagtcac |
50523932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University