View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18769_high_16 (Length: 321)

Name: NF18769_high_16
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18769_high_16
NF18769_high_16
[»] chr2 (3 HSPs)
chr2 (1-168)||(4546962-4547129)
chr2 (262-301)||(4547305-4547344)
chr2 (200-230)||(4547158-4547188)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 4546962 - 4547129
Alignment:
1 gtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4546962 gtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttca 4547061  T
101 tactaaggtgtactgttacttactttttattatctaccactaatctattaaatttgtccagtccaagt 168  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4547062 tactaaggtctactgctacttactttttattatctaccactaatctattaaatttctccagtccaagt 4547129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 301
Target Start/End: Original strand, 4547305 - 4547344
Alignment:
262 agatagagatttcgtatactaatcttttggcgatctagat 301  Q
    |||||||||| |||||||||||||||||||||||||||||    
4547305 agatagagatgtcgtatactaatcttttggcgatctagat 4547344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 230
Target Start/End: Original strand, 4547158 - 4547188
Alignment:
200 gaccaaaccaacaaagggaaaacacattcga 230  Q
    |||||||||||||||||||||||||||||||    
4547158 gaccaaaccaacaaagggaaaacacattcga 4547188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University