View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_high_21 (Length: 276)
Name: NF18769_high_21
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 13018488 - 13018378
Alignment:
| Q |
1 |
tcctcgctgttaattggatccaatgtcatgtgcgccgagatgcatgctgagcaatctcatctgcagctacttttatatttctttcctagcagcactaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
13018488 |
tcctcgctgttaattggatccaatgtcatgtgcgccgagatgcatgctgagcaatctcatctgcagctacttttatatttctttcccagcagcattaacg |
13018389 |
T |
|
| Q |
101 |
atattcatgat |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
13018388 |
atattcatgat |
13018378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 163 - 266
Target Start/End: Complemental strand, 13018331 - 13018223
Alignment:
| Q |
163 |
gaaatgccatgtcatctgttgtcaattttagcttaaacaat---tgattca--tataatttttactttttaatacgatattttcgaatgtggcttagcta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||| |||||||| |||||||| | ||| |
|
|
| T |
13018331 |
gaaatgccatgtcatctgttgtcaattttagcttaaacaacaagtgattcaaatataatttttacttttcaataagatatttttagatgtggctcaacta |
13018232 |
T |
|
| Q |
258 |
tagtgatga |
266 |
Q |
| |
|
| ||||||| |
|
|
| T |
13018231 |
tggtgatga |
13018223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University