View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_high_25 (Length: 254)
Name: NF18769_high_25
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 25304043 - 25303812
Alignment:
| Q |
1 |
gcttgttattcaggaggaggccttttggaaacaaagagctaagatgcactggttgaaacaaagggacgtgaatacaaggttcttttacatgtccactgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25304043 |
gcttgttattcaggaggaggccttttggaaacaaagagctaagatgcactggttgaaacaaagggacgtgaatagaaggttcttttacatgtccactgtt |
25303944 |
T |
 |
| Q |
101 |
tcgagaggtaaagtcaagaaagttataaaactggtgtctgataatggttatttggttatgagataggagcacctatgtgatgtagcaaagaattattttg |
200 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25303943 |
tctagaggtaaagtcaagaaagttacaaaactggtgtttgataatggttatttggttatgagataggagcacctatgtgatgtagcaaataattattttg |
25303844 |
T |
 |
| Q |
201 |
atgtggtttttgcggccaacaatggtaaccat |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
25303843 |
atgtggtttttgcagccaacaatggtaaccat |
25303812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Original strand, 7124477 - 7124523
Alignment:
| Q |
11 |
caggaggaggccttttggaaacaaagagctaagatgcactggttgaa |
57 |
Q |
| |
|
||||||||||| |||||||| |||||||| || |||||||||||||| |
|
|
| T |
7124477 |
caggaggaggcgttttggaagcaaagagcaaaaatgcactggttgaa |
7124523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University