View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_high_26 (Length: 246)
Name: NF18769_high_26
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 11858653 - 11858469
Alignment:
| Q |
17 |
gtaggatcttagagatggaatgggaaatcatggctacgtccattgttcttgtgt-------gtgaaaatcttcnnnnnnn-ttggatggaaagtgctctg |
108 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| | |
|
|
| T |
11858653 |
gtaggatgttggagatggaatgggaaagcatggctacgtccattgttcttgtgttttgtgtgtgaaaatcttcaaaaaaaattggatggaaagtgctcag |
11858554 |
T |
|
| Q |
109 |
-taattagggtggaagaagaagatactgttgctcactattatctcgtatctgtagtgatcactacatttttcaactctcttaata |
192 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11858553 |
gtaattagggtggatggtgaagataccattgctcactattatctagtatatgtagtgatcactacatttttcaacactcttaata |
11858469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 11826464 - 11826420
Alignment:
| Q |
17 |
gtaggatcttagagatggaatgggaaatcatggctacgtccattg |
61 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
11826464 |
gtaggatgttggagatggaatgggaaagcatggctacgtccattg |
11826420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 62
Target Start/End: Complemental strand, 12037455 - 12037421
Alignment:
| Q |
28 |
gagatggaatgggaaatcatggctacgtccattgt |
62 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12037455 |
gagattgaatgggaaatcatggctacgtccattgt |
12037421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University