View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_high_27 (Length: 244)
Name: NF18769_high_27
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_high_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 43483266 - 43483040
Alignment:
| Q |
18 |
aacatctgggtctactttgagtgagacagtgtcgccgatgccatcgacagcgcagccaaggaaatcgaagccaggacctagattggcgacggtggcagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483266 |
aacatctgggtctactttgagtgagacagtgtcgccgatgccatcgacagcgcagccaaggaaatcgaagccaggacctagattggcgacggtggcagga |
43483167 |
T |
 |
| Q |
118 |
gcaaaggccttgacggaagaatagacaggtggtgggtcggtagtaagtgtgacgacagaggaatgcttctgagaggtgttgcagcatctgattctaaaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43483166 |
gcaaaggccttgacggaagaatagacaggtggtgggtcggtagtaagtgtgacgacagaggaatgcttctgagaggtgttgtagcatctgattctaaaaa |
43483067 |
T |
 |
| Q |
218 |
ttgaaatatgaatctgattattctttt |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43483066 |
ttgaaatatgaatctgattattctttt |
43483040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 144
Target Start/End: Original strand, 43558083 - 43558124
Alignment:
| Q |
103 |
gcgacggtggcaggagcaaaggccttgacggaagaatagaca |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
43558083 |
gcgacggtggccggagcaaaggccttgacggaggagtagaca |
43558124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University