View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18769_high_31 (Length: 217)

Name: NF18769_high_31
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18769_high_31
NF18769_high_31
[»] chr5 (1 HSPs)
chr5 (19-206)||(40265246-40265433)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 40265433 - 40265246
Alignment:
19 gcaacacctctttgtgttgcaacatagattactgctaccagttaaccaatatatgcatgcattctattcaactaattaccatgactttcttttacatagg 118  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40265433 gcaacacttctttgtgttgcaacatagattactgctaccagttaaccaatatatgcatgcattctattcaactaattaccatgactttcttttacatagg 40265334  T
119 ttgcaatagctttgccattcaaatatggcagacattgctctctccgttgcagccaaggtttcagaatatttggtcaagcctttgctac 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
40265333 ttgcaatagctttgccattcaaatatggcagacattgctctctccgttgcagccaaggtttcagaatatttggtcaagcctttactac 40265246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University