View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_low_12 (Length: 401)
Name: NF18769_low_12
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 385
Target Start/End: Original strand, 3568595 - 3568979
Alignment:
| Q |
1 |
tccaacatttctcccaagaggaagtgtgcatagaccacacgattgaaggaatacgcccttctggctcctcacccacattggcgcatcagcagaatgatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568595 |
tccaacatttctcccaagaggaagtgtgcatagaccacatgattgaaggaatacgcccttctggctcctcacccacattggcgcatcagcagaatgatct |
3568694 |
T |
 |
| Q |
101 |
tgctaactcggccaacatagcacatttagattatgagggcgtgcacagtgaggagcaacagctggttgcacgtgaggatgctgcccattcagatatctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568695 |
tgctaactcggccaacatagcacatttggattatgagggcgtgcacagtgaggagcaacagctggttgcacgtgaggatgctgcccattcagatatctct |
3568794 |
T |
 |
| Q |
201 |
atggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatacatcctaacatccaacatgacatggaacttgttggtaattcagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568795 |
atggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatatatcctaacatccaacatgacatggaacttgttggtaattcagg |
3568894 |
T |
 |
| Q |
301 |
taccgtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggt |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3568895 |
taccgtcatgtctgaagatagtagcatgcttgcggttcaacctggttttttggcagatgatatagttcataatagtaacacaggt |
3568979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 389
Target Start/End: Original strand, 18485273 - 18485357
Alignment:
| Q |
305 |
gtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggttctg |
389 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |||||| | || |||||| |||||||| |
|
|
| T |
18485273 |
gtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University