View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18769_low_16 (Length: 321)
Name: NF18769_low_16
Description: NF18769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18769_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 4546962 - 4547129
Alignment:
| Q |
1 |
gtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546962 |
gtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttca |
4547061 |
T |
 |
| Q |
101 |
tactaaggtgtactgttacttactttttattatctaccactaatctattaaatttgtccagtccaagt |
168 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4547062 |
tactaaggtctactgctacttactttttattatctaccactaatctattaaatttctccagtccaagt |
4547129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 301
Target Start/End: Original strand, 4547305 - 4547344
Alignment:
| Q |
262 |
agatagagatttcgtatactaatcttttggcgatctagat |
301 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4547305 |
agatagagatgtcgtatactaatcttttggcgatctagat |
4547344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 230
Target Start/End: Original strand, 4547158 - 4547188
Alignment:
| Q |
200 |
gaccaaaccaacaaagggaaaacacattcga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4547158 |
gaccaaaccaacaaagggaaaacacattcga |
4547188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University