View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1876_low_17 (Length: 275)
Name: NF1876_low_17
Description: NF1876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1876_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 31 - 269
Target Start/End: Original strand, 42186680 - 42186922
Alignment:
| Q |
31 |
aagggatggatggtggccttcgatgcaatttcaatatgaaattttattcatagtgtgagggatggatacactttgttccgtgnnnnnnnnn-aacccgaa |
129 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42186680 |
aagggatggatgatggccttcgatgcaatttcaatatgaaattttattcatagtgtgagggatggatacactttgttccgtgttttttttgtaacccgaa |
42186779 |
T |
|
| Q |
130 |
atgctagatgatgcctatgtcaaaactagttgttgcctt------aattgtagttttttatatagcgtggaggatagaaattatgtgggatatctatcga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42186780 |
atgctagatgatgcctatgtcaaaactagttgttgcctttgccttaattgcagtttgttatatagcgtggaggatagaaat---gtgggatatctatcga |
42186876 |
T |
|
| Q |
224 |
ataatcaataatatgagtttgttatgggcagttgacatcatgattc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42186877 |
ataatcaataatatgagtttgttatgggcagttgacatcatgattc |
42186922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University