View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1876_low_19 (Length: 267)
Name: NF1876_low_19
Description: NF1876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1876_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 3343823 - 3344062
Alignment:
| Q |
11 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaagaaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
3343823 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcatgagactgctcatcgacgagttggaagaagaaga |
3343922 |
T |
|
| Q |
111 |
gggaaaccttgaactacaatttatggggttctattgtttatgcttatgcagtgatttttggggatgatttaannnnnnnnnnnnnnagggatttgattta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3343923 |
gggaaaccttgaactacaatttatggggttctattgtttatgtttatgcagtgatttttggggatgatttaattttttttctttttagggatttgatttg |
3344022 |
T |
|
| Q |
211 |
catgcagaatgcataattacagtttctggggttctattgt |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3344023 |
catgcagaatgcataattatagtttctggggttctattgt |
3344062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 11 - 182
Target Start/End: Original strand, 47527502 - 47527679
Alignment:
| Q |
11 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaagaaga |
110 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47527502 |
gaagcataggcgtgtctctttcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaacaaga |
47527601 |
T |
|
| Q |
111 |
gggaaaccttgaactacaatttatggggttctattgtttat-------gcttatgcagtgatttttggggatgatttaa |
182 |
Q |
| |
|
|| |||||||||| |||||||| | || ||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
47527602 |
ggaaaaccttgaattacaattt-ttggattctattgtttattgcttacgtttatgcaatgatttttggggatgatttaa |
47527679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University