View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18772_high_12 (Length: 308)
Name: NF18772_high_12
Description: NF18772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18772_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 59 - 129
Target Start/End: Original strand, 43017057 - 43017127
Alignment:
| Q |
59 |
tgacattgtggttgtagaatcctcaatatacttgatgtgagacctgaatcgttgtgatagatccttaaaaa |
129 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017057 |
tgacattgtggttgtagaatcatcaatatacttgatgtgagacctgaatcgttgtgatagatccttaaaaa |
43017127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 201 - 252
Target Start/End: Original strand, 43017130 - 43017181
Alignment:
| Q |
201 |
gaactacttttactccatgatttctttaaattcacaacctgttctttccagt |
252 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017130 |
gaactatttttacttcatgatttctttaaattcacaacctgttctttccagt |
43017181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 43017200 - 43017229
Alignment:
| Q |
263 |
tagtatttgttcggttttgttcatttacaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43017200 |
tagtatttgttcggttttgttcatttacaa |
43017229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University