View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18772_high_19 (Length: 234)
Name: NF18772_high_19
Description: NF18772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18772_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 14 - 155
Target Start/End: Original strand, 3650220 - 3650361
Alignment:
| Q |
14 |
ttgacctctcatcctttcaactcacatcagttacatttctccatggccaataacgatatccaggttttgctttcatactacttcatgactggtatgtgca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3650220 |
ttgacctctcatcctttcaactcacatcagttacatttctccatggccaataacgatatccaggttttgctttcatactacttcatgactggtatgtgca |
3650319 |
T |
|
| Q |
114 |
ttctatattcctgatactgaaatttgtttatgtgtttgtacc |
155 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
3650320 |
ttctatattcgtgatactgaaatttgtttatgtttttgtacc |
3650361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 146 - 233
Target Start/End: Original strand, 3650880 - 3650967
Alignment:
| Q |
146 |
tgtttgtaccagcacctttgcacccaaatccgagtccgagttggagaagatcgtcaatgatcttcgaatcaaataccgcacgtatgtt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3650880 |
tgtttgtaccagcacctttgcacccaaatccgagtccgagttggagaagatcgtcaatgatcttcgaatcaaataccgcacgtatgtt |
3650967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 38467207 - 38467171
Alignment:
| Q |
187 |
tggagaagatcgtcaatgatcttcgaatcaaataccg |
223 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38467207 |
tggagaagatcgtcaatgatcttagaatcaaataccg |
38467171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 35349487 - 35349551
Alignment:
| Q |
169 |
ccaaatccga-gtccgagttggagaagatcgtcaatgatcttcgaatcaaataccgcacgtatgt |
232 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
35349487 |
ccaaatccgacgaccgagctggagaagatcgtcaatgatcttagaatcaaataccgaacctatgt |
35349551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University